11/16/2010

GGGGACAAGTTTGTAC....

Офіційно визнаю, що найбільші задроти, це саме біологи. Зрозумів це, після такого от речення в статті, яку перечитував:

"We constructed a Gateway compatible Ci-ZO-1 clone by PCR-amplifying the coding sequence from a cDNA clone (Cicl035p23, gift of Yutaka Satou and Nori Satoh) flanked by gateway compatible attR1-attR2 sequences (forward primer: 5'GGGGACAAGTTTGTACAAAAAAGCAGGCTCAGAAAAAATGATGGATGAGCTAATATGGCAGGAGC3', reverse primer: 5'GGGGACCACTTTGTACAAGAAAGCTGGGTTGAAATGGTCGATAAGAACAGAAACGC3' )."

Думаю, єдина можлива помста, це висловлюватися в бінарному коді, або хоча б у хексах!


Дописати коментар